QIAGEN Website    Quick Order    Online Seminar    Contact    My Account
Home  >  Products and Services  >  PCR Home  >  Custom PCR Array

Custom miScript miRNA PCR Arrays

Custom miScript PCR Arrays Tailored to Your Research
Custom miScript miRNA PCR Arrays can be made to include any set of human, mouse, rat, and dog miScript Primer Assays. Custom PCR Arrays are available in 96-well plates, 384-well plates, and 100-Well Rotor-Disc, for use with most real-time PCR instruments. Since these arrays can be manufactured with almost any panel layout (see below) using miScript Primer Assays as well as any of miScript Control Assays, they can be configured for almost any research requirement that requires profiling of mature miRNA expression.

Custom miScript miRNA PCR Arrays use the same optimized miScript PCR System Components as the standard catalog arrays.

Why Custom miScript miRNA PCR Arrays?

  • Reproducible results and consistent performance due to rigorous QC processes
  • Fast turn-around time
  • Simple data analysis using your miRNA list on either web software or Excel templates

NOTE: Custom miScript miRNA PCR Arrays can potentially be designed for other species' genomes for an extra fee to cover the new species genome database. Please contact QIAGEN SABiosciences Technical Support at 1-888-503-3187 for additional information regarding this service

miScript miRNA PCR Arrays are intended for molecular biology applications. This product is not intended for the diagnosis, prevention or treatment of a disease.

Plate Layouts Performance Controls & Data Analysis
 
Options for Customizing PCR Arrays
  1. Build Your Own Custom PCR Arrays: Provide Your Own List of Genes

  2. Choose a PCR Array Plate Format

How to Order:

  1. Select a plate layout to match the gene number and the number of samples you would like to analyze.
    • Please have the type of RT-PCR instrument available when placing the order.
  2. Determine the number and types of plates required for your experiment.
  3. Use the following Excel file to enter your gene list.
    • Please supply the current Gene Symbol and RefSeq number for each gene.
    • To find the miRBase number for your gene, please visit: QIAGEN GeneGlobe or miRBase web pages.
  4. Contact QIAGEN SABiosciences Technical Support at 1-888-503-3187 to submit your gene list and obtain a quote.
Back to Top
 

Plate Layouts Performance Controls & Data Analysis
 

Discrimination & Specificity, Sensitivity & Dynamic Range, Reproducibility

Real-time RT-PCR is the most sensitive and reliable method for analyzing the expression of nucleic acids like miRNA. Its wide dynamic range makes it the preferred choice for simultaneously quantifying both rare and abundant sequences in the same sample. However, the small size and high degree of similarity among miRNA sequences makes quantitative analyses of their abundance very challenging. Any assay for miRNA must not only demonstrate the sensitivity and reproducibility expected of real-time PCR, but also be specific enough to discriminate between sequences that differ by as little as one mismatch. The experimental results below will show that the miScript PCR Array System meets these performance criteria.

miScript miRNA Assay Design Improves Discrimination & Specificity

The proprietary primer design of the miScript miRNA PCR Array and Assays distinguishes miRNA family members with single nucleotide mismatches providing greater discrimination and specificity than other commercial providers.


miRNA sequence

 Let-7b

 UGAGGUAGUAGGUUGUGUGGUU

 Let-7c

 UGAGGUAGUAGGUUGUAUGGUU

 miR-98

 UGAGGUAGUAAGUUGUAUUGUU

 Let-7d

 AGAGGUAGUAGGUUGCAUAGUU

 Let-7e

 UGAGGUAGGAGGUUGUAUAGUU

 Let-7a

 UGAGGUAGUAGGUUGUAUAGUU

 Let-7f

 UGAGGUAGUAGAUUGUAUAGUU

 Let-7g

 UGAGGUAGUAGUUUGUACAGUU

 Let-7i

 UGAGGUAGUAGUUUGUGCUGUU

 

 

cDNA prepared using HiSpec Buffer: Relative detection (as % of perfect match)

cDNA used in PCR

miScript Primer Assay Used

Let-7b

Let-7c

miR-98

Let-7d

Let-7e

Let-7a

Let-7f

Let-7g

Let-7i

Let-7b

100.00

1.62

0.00

0.00

0.01

0.01

0.00

0.01

0.00

Let-7c

2.03

100.00

0.00

0.00

5.92

0.38

0.00

0.00

0.00

miR-98

0.00

0.00

100.00

0.00

0.01

0.00

0.00

0.00

0.01

Let-7d

0.00

0.01

0.00

100.00

0.00

2.48

0.00

0.00

0.00

Let-7e

0.00

0.00

0.00

0.02

100.00

0.67

0.01

0.00

0.00

Let-7a

0.00

1.46

0.01

0.76

6.27

100.00

0.29

0.04

0.00

Let-7f

0.00

0.01

0.00

0.01

0.03

0.97

100.00

0.04

0.00

Let-7g

0.00

0.00

0.00

0.00

0.00

0.00

0.00

100.00

0.00

Let-7i

0.00

0.00

0.01

0.00

0.00

0.00

0.00

0.67

100.00

The RNA sequences of the Let-7 isoforms are shown. Base changes are bold and underlined. Synthetic miRNAs of each Let-7 isoform were used in cDNA synthesis reactions performed with the miScript II RT Kit using miScript HiSpec Buffer. An aliquot of each cDNA was used as template in real-time PCR reactions with a miScript Primer Assay for each isoform and the miScript SYBR Green PCR Kit. The % relative detection was calculated using the differences between the CT values achieved from the mismatching miScript Primer Assays and those from the perfectly matching miScript Primer Assays (% relative detection = 2-ΔCT x 100). This data demonstrates the ability of the miScript PCR System to efficiently discriminate between closely related isoform family members.

 

Unique Patent-Pending RT Chemistry Decreases Non-Specific Background Signals that Plague Other Commercially Available Products

The patent-pending chemistry of the miScript II RT Kit using HiSpec Buffer preferentially reverse transcribes mature miRNA, thereby decreasing non-specific background and increasing sensitivity. miScript Primer Assays can provide three orders of magnitude greater sensitivity than competing miRNA qPCR assays. Other assays can amplify non-specific products that tend to be more evident at lower amounts of input material.


Total RNA was purified from HeLa S3 cells using the miRNeasy Mini Kit. cDNA was prepared from 500 ng of total in a miScript II reverse transcription reaction using HiSpec Buffer. For Company X, cDNA was prepared from 500 ng according to the user manual. Each cDNA was then used as a template in real-time PCR reactions using either the Human miRNome miScript miRNA PCR Array (miScript) or Company X miRNome PCR Array. This data demonstrates the background-eliminating chemistry of the miScript II RT Kit using HiSpec Buffer.

The miScript PCR System Offers Exceptional Dynamic Range and Copy Number Linearity

The miScript PCR System, with cDNA prepared using HiSpec Buffer demonstrates linearity from 2 µg to as low as 10 pg input total RNA or from 10 to more than 106 copies of miRNA cDNA template. The wide dynamic range means that miRNA sequences expressed at vastly different amounts can be detected simultaneously.


A Highly linear cDNA synthesis reactions. Total RNA was purified from HeLa S3 cells using the miRNeasy Mini Kit. cDNA was prepared in a miScript II reverse transcription reaction using HiSpec Buffer for a range of RNA amounts from 10 pg to 2 µg. Each cDNA was then used as a template in real-time PCR reactions using a miScript Primer Assay for 3 mature miRNAs (miR-16, miR-20a, and miR-21) and the miScript SYBR Green PCR Kit. This data demonstrates the broad dynamic detection range that is achievable when using the miScript II PCR System. B Synthetic miR-21 was used to generate cDNA using the miScript II Reverse Transcription Kit under both the HiSpec and HiFlex buffering conditions. A range of amounts from 10 copies to 106 copies of this cDNA was used in real-time PCR using the miScript PCR System. Real-time PCR was performed on the Rotor-Gene Q real-time PCR insturment. The resultant CT values decreased linearly with increasing miRNA copy number, indicating sensitive detection from a wide range of template amounts.

miScript miRNA PCR Arrays Enable High Experimental Reproducibility

Total RNA was purified using the miRNeasy Minit Kit from A 2 identical HeLa S3 cell pellets with identical passage numbers and B 2 HeLa S3 cell pellets collected from different parental stocks at different times. Using the miScript PCR System, cDNA was prepared and used as a template in real-time PCR with the miFinder miScript miRNA PCR Array. Plotting CT values of the replicates against each other demonstrated the high technical and biological reproducibility of the results. These experiments were performed by a first-time user of the miScript PCR System.

miScript miRNA PCR Arrays Enable Low Operator to Operator Variation, even when preamplification is performed


These data demonstrate the high operator to operator reproducibility that is achievable when using the miScript PCR System. cDNA was prepared from a human universal reference RNA sample using the miScript II RT Kit with miScript HiSpec Buffer. Three different users performed preamplification using the miScript PreAMP PCR Kit and miFinder miScript PreAMP Pathway Primer Mix. Preamplified cDNA was used for miRNA profiling in duplicate with the miFinder miScript miRNA PCR Array. High levels of correlation were observed between users when CT values were A compared on a scatter plot or B plotted for all 3 users.
 

 

Plate Layouts Performance Controls & Data Analysis
 

miScript  miRNA PCR Array System Controls

C. elegans miR-39 miScript Primer Assay

The miScript Primer Assay for C. elegans miR-39 detects the miRNeasy Serum/Plasma Spike-In Control (cat. no. 219610), (also called Syn-cel-miR-39 miScript miRNA Mimic [cat. no. MSY0000010]), which is a C. elegans miR-39 mimic. This mimic can be added to samples, particularly serum or plasma samples, to control for variations during the preparation of total RNA and subsequent steps. After purification, real-time RT-PCR detection of the miRNeasy Serum/Plasma Spike-In Control can be performed and these results can then be used for normalization of real-time RT-PCR results for endogenous miRNAs in the sample.

snoRNA/snRNA miScript PCR Controls

For accurate and reproducible results in miRNA quantification by real-time PCR, it is necessary to normalize the amount of target miRNA by using a suitable endogenous reference RNA. This approach is known as relative quantification. Normalization corrects for factors that could otherwise lead to inaccurate quantification. These factors include variation in quantity of input RNA, possible RNA degradation or presence of inhibitors in the RNA samples, and differences in sample handling. Normalization also allows results from different experiments and samples to be compared directly. miScript PCR Controls are primers designed to quantify a panel of 5 snoRNAs (SNORD61, SNORD68, SNORD72, SNORD95, and SNORD96A) and the snRNA RNU6B (RNU6-2). These controls take into consideration sequence homologies in human, mouse, rat, dog, and rhesus macaque so that the same controls can be used for all 4 species. In addition, these small RNAs have been verified to have relatively stable expression levels across tissues and cell types. As a result, miScript PCR Controls serve as normalization controls for relative quantification using the miScript PCR System. All the controls have amplification efficiencies close to 100%.

Reverse transcription control

The miRTC miScript Primer Assay is an assay that assesses the performance of a reverse-transcription reaction using the miScript II RT Kit by detecting template synthesized from the kit’s built-in miRNA reverse transcription control RNA (miRTC). This control monitors for any variables that may inhibit the reverse transcription reaction.

Positive PCR control

The positive PCR control (PPC) wells contain a predispensed artificial DNA sequence and the assay that detects it. This control monitors for any variables that may inhibit the PCR reaction.

Back to Top