QIAGEN Website    Quick Order    Online Seminar    Contact    My Account
Home  >  Products and Services  >  miRNA Home  >  miRNA PCR Arrays

miScript miRNA PCR Array

miScript miRNA PCR Arrays contain miScript Primer Assays that have been arrayed into full miRNome, high content, and biologically or disease relevant panels. This next generation of miRNA PCR arrays builds on the original strengths of the RT² miRNA PCR Arrays* with expanded species coverage, expanded assay coverage, and expanded pathway- and disease-focused content. miScript PCR arrays are provided in ready-to-use 96-well plate, 384-well plate, and 100-well Rotor-Disc formats compatible with all popular real-time thermal cyclers. All miScript Arrays are partially or fully customizable for content. Our proprietary miRNA detection technologies enable uniformly high PCR amplification efficiencies, allowing simultaneous detection of any or all miRNA species under uniform cycling conditions. Furthermore, each assay in a miScript miRNA PCR Array has been bench verified to ensure sensitive and specific detection of mature miRNA by real-time PCR. The above features place miScript miRNA PCR Arrays at the forefront of miRNA expression profiling technologies. Mature miRNA expression profiling is now within reach of every laboratory because of the ease, convenience, and consistent performance of miScript miRNA PCR Arrays.

*Important: miScript miRNA PCR System components are NOT interchangeable with RT² miRNA PCR Array components or cDNAs prepared from RT² miRNA First Strand Kits. To finish established projects initiated with the RT² miRNA System, researchers may continue to order (for a limited time) RT² miRNA PCR Arrays, miRNA qPCR Assays and RT² miRNA First Strand Kits by contacting SABiosciences at 888-503-3187 or support@sabiosciences.com.

miScript miRNA PCR Array solutions for miRNA expression profiling

miRNome miScript miRNA PCR Arrays offer the largest, preformatted miRNome content.

miRNome Array Offerings Species
miRNome - 96 Well Format Human    Mouse    Rat    Dog   Rhesus Macaque
miRNome - 384 Well Format Human    Mouse    Rat    Dog   Rhesus Macaque

High Content miScript miRNA PCR Arrays offer an economical alternative to miRNome profiling. Where applicable, QIAGEN in-house expression profiling data has been incorporated to derive content.

Hign Content Array Offerings Species
miFinder 384HC New! Human    Mouse   
Liver miFinder 384HC New! Human
Cancer PathwayFinder 384HC New! Human    Mouse   
Serum & Plasma 384HC New! Human

Focused miScript miRNA PCR Arrays are miRNA primer assays that have been arrayed into biological relevant panels using the latest published literature and state-of-the-art bioinformatics.

Focused Array Offerings Species
miFinder Human    Mouse    Rat    Dog   Rhesus Macaque
Apoptosis New! Human    Mouse    Rat
Brain Cancer Human    Mouse    Rat
Breast Cancer Human    Mouse    Rat
Cancer PathwayFinder Human    Mouse    Rat
Cardiovascular Disease   New! Human    Mouse    Rat              Rhesus Macaque
Cell Differentiation & Development Human    Mouse    Rat
Diabetes   New! Human    Mouse    Rat
Immunopathology Human    Mouse    Rat
Inflammatory Response and Autoimmunity Human    Mouse    Rat
Liver miFinder New! Human    Mouse    Rat
Neurological Development & Disease Human    Mouse    Rat
Ovarian Cancer Human    Mouse    Rat
Prostate Cancer   New! Human    Mouse    Rat
Serum & Plasma Human    Mouse    Rat
T-Cell & B-Cell Activation  New! Human    Mouse    Rat
miRNA QC Human    Mouse    Rat    Dog    Rhesus Macaque

Don't see the pathway focus that fits your requirements? Try a Custom miScript miRNA PCR Array!

Tell us which disease or biological content you are interested in!

miRNA Expression Profiling Workflow:

miScript miRNA PCR Arrays are compatible with a wide range of real-time PCR instruments
Download real-time PCR instrument setup instructions and run templates
here.

Well Designed Layout and Controls
miScript miRNA PCR Arrays are available in ready-to-use 96-well plate, 384-well plate, and 100-well Rotor-Disc formats to profile the expression of 84 or 372 miRNA sequences in one real-time PCR run. In addition, twelve controls are included on each PCR array that offer solutions to assess RNA recovery efficiency, normalize data for the ΔΔCT method of relative quantification, monitor reverse transcription efficiency, and monitor real-time PCR reaction efficiency. �See the anatomy of miScript miRNA PCR Arrays and learn the purpose of each PCR array control.

Easy-to-Use Data Analysis
Download an easy-to-use Excel-based data analysis template [here]. Data analysis is based on the ΔΔCT method of relative quantification.

Have the Experts Perform your miScript miRNA PCR Arrays

The Service Core for Gene Expression and Genomic Analysis comprises a group of highly skilled scientist adept at miRNA expression profiling using miScript miRNA PCR Arrays

Performance

Discrimination & Specificity, Sensitivity & Dynamic Range, Reproducibility

Real-time RT-PCR is the most sensitive and reliable method for analyzing the expression of nucleic acids like miRNA. Its wide dynamic range makes it the preferred choice for simultaneously quantifying both rare and abundant sequences in the same sample. However, the small size and high degree of similarity among miRNA sequences makes quantitative analyses of their abundance very challenging. Any assay for miRNA must not only demonstrate the sensitivity and reproducibility expected of real-time PCR, but also be specific enough to discriminate between sequences that differ by as little as one mismatch. The experimental results below will show that the miScript PCR Array System meets these performance criteria.

miScript miRNA Assay Design Improves Discrimination & Specificity

The proprietary primer design of the miScript miRNA PCR Array and Assays distinguishes miRNA family members with single nucleotide mismatches providing greater discrimination and specificity than other commercial providers.


miRNA sequence

 Let-7b

 UGAGGUAGUAGGUUGUGUGGUU

 Let-7c

 UGAGGUAGUAGGUUGUAUGGUU

 miR-98

 UGAGGUAGUAAGUUGUAUUGUU

 Let-7d

 AGAGGUAGUAGGUUGCAUAGUU

 Let-7e

 UGAGGUAGGAGGUUGUAUAGUU

 Let-7a

 UGAGGUAGUAGGUUGUAUAGUU

 Let-7f

 UGAGGUAGUAGAUUGUAUAGUU

 Let-7g

 UGAGGUAGUAGUUUGUACAGUU

 Let-7i

 UGAGGUAGUAGUUUGUGCUGUU

 

 

cDNA prepared using HiSpec Buffer: Relative detection (as % of perfect match)

cDNA used in PCR

miScript Primer Assay Used

Let-7b

Let-7c

miR-98

Let-7d

Let-7e

Let-7a

Let-7f

Let-7g

Let-7i

Let-7b

100.00

1.62

0.00

0.00

0.01

0.01

0.00

0.01

0.00

Let-7c

2.03

100.00

0.00

0.00

5.92

0.38

0.00

0.00

0.00

miR-98

0.00

0.00

100.00

0.00

0.01

0.00

0.00

0.00

0.01

Let-7d

0.00

0.01

0.00

100.00

0.00

2.48

0.00

0.00

0.00

Let-7e

0.00

0.00

0.00

0.02

100.00

0.67

0.01

0.00

0.00

Let-7a

0.00

1.46

0.01

0.76

6.27

100.00

0.29

0.04

0.00

Let-7f

0.00

0.01

0.00

0.01

0.03

0.97

100.00

0.04

0.00

Let-7g

0.00

0.00

0.00

0.00

0.00

0.00

0.00

100.00

0.00

Let-7i

0.00

0.00

0.01

0.00

0.00

0.00

0.00

0.67

100.00

The RNA sequences of the Let-7 isoforms are shown. Base changes are bold and underlined. Synthetic miRNAs of each Let-7 isoform were used in cDNA synthesis reactions performed with the miScript II RT Kit using miScript HiSpec Buffer. An aliquot of each cDNA was used as template in real-time PCR reactions with a miScript Primer Assay for each isoform and the miScript SYBR Green PCR Kit. The % relative detection was calculated using the differences between the CT values achieved from the mismatching miScript Primer Assays and those from the perfectly matching miScript Primer Assays (% relative detection = 2-ΔCT x 100). This data demonstrates the ability of the miScript PCR System to efficiently discriminate between closely related isoform family members.

Unique Patent-Pending RT Chemistry Decreases Non-Specific Background Signals that Plague Other Commercially Available Products

The patent-pending chemistry of the miScript II RT Kit using HiSpec Buffer preferentially reverse transcribes mature miRNA, thereby decreasing non-specific background and increasing sensitivity. miScript Primer Assays can provide three orders of magnitude greater sensitivity than competing miRNA qPCR assays. Other assays can amplify non-specific products that tend to be more evident at lower amounts of input material.


Total RNA was purified from HeLa S3 cells using the miRNeasy Mini Kit. cDNA was prepared from 500 ng of total in a miScript II reverse transcription reaction using HiSpec Buffer. For Company X, cDNA was prepared from 500 ng according to the user manual. Each cDNA was then used as a template in real-time PCR reactions using either the Human miRNome miScript miRNA PCR Array (miScript) or Company X miRNome PCR Array. This data demonstrates the background-eliminating chemistry of the miScript II RT Kit using HiSpec Buffer.

The miScript PCR System Offers Exceptional Dynamic Range and Copy Number Linearity

The miScript PCR System, with cDNA prepared using HiSpec Buffer demonstrates linearity from 2 �g to as low as 10 pg input total RNA or from 10 to more than 106 copies of miRNA cDNA template. The wide dynamic range means that miRNA sequences expressed at vastly different amounts can be detected simultaneously.


A Highly linear cDNA synthesis reactions. Total RNA was purified from HeLa S3 cells using the miRNeasy Mini Kit. cDNA was prepared in a miScript II reverse transcription reaction using HiSpec Buffer for a range of RNA amounts from 10 pg to 2 �g. Each cDNA was then used as a template in real-time PCR reactions using a miScript Primer Assay for 3 mature miRNAs (miR-16, miR-20a, and miR-21) and the miScript SYBR Green PCR Kit. This data demonstrates the broad dynamic detection range that is achievable when using the miScript II PCR System. B Synthetic miR-21 was used to generate cDNA using the miScript II Reverse Transcription Kit under both the HiSpec and HiFlex buffering conditions. A range of amounts from 10 copies to 106 copies of this cDNA was used in real-time PCR using the miScript PCR System. Real-time PCR was performed on the Rotor-Gene Q real-time PCR insturment. The resultant CT values decreased linearly with increasing miRNA copy number, indicating sensitive detection from a wide range of template amounts.

miScript miRNA PCR Arrays Enable High Experimental Reproducibility

Total RNA was purified using the miRNeasy Minit Kit from A 2 identical HeLa S3 cell pellets with identical passage numbers and B 2 HeLa S3 cell pellets collected from different parental stocks at different times. Using the miScript PCR System, cDNA was prepared and used as a template in real-time PCR with the miFinder miScript miRNA PCR Array. Plotting CT values of the replicates against each other demonstrated the high technical and biological reproducibility of the results. These experiments were performed by a first-time user of the miScript PCR System.

miScript miRNA PCR Arrays Enable Low Operator to Operator Variation, even when preamplification is performed


These data demonstrate the high operator to operator reproducibility that is achievable when using the miScript PCR System. cDNA was prepared from a human universal reference RNA sample using the miScript II RT Kit with miScript HiSpec Buffer. Three different users performed preamplification using the miScript PreAMP PCR Kit and miFinder miScript PreAMP Pathway Primer Mix. Preamplified cDNA was used for miRNA profiling in duplicate with the miFinder miScript miRNA PCR Array. High levels of correlation were observed between users when CT values were A compared on a scatter plot or B plotted for all 3 users.

Applications

Circulating Biomarker Discovery using the miScript PCR System


Total RNA was isolated from 200 �l normal and lung cancer serum samples (3 each) using the miRNeasy Serum/Plasma Kit. RNA was eluted using 14 �l nuclease free-water. For reverse transcription, one-tenth of the RNA eluate was reverse transcribed into cDNA using the miScript II RT Kit with miScript HiSpec Buffer. The Human Serum & Plasma 384HC miScript miRNA PCR Array, in combination with the miScript PCR System, was used to profile mature miRNA expression by real-time PCR. The miRNeasy Serum/Plasma Spike-In Control was used to calibrate the data, and a plate mean of commonly expressed miRNAs was used for normalization. In total, the expression of 183 mature miRNAs was detected. Included in the miRNAs that exhibited significant upregulation are hsa-miR-25 and hsa-miR-223, which have previously been shown to be blood-based markers for patients with lung cancer (1).
1. Chen X, et al. (2008) Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res. 18, 997.

High quality, rapid miRNA Expression Profiling using FFPE Samples


Total RNA was isolated from thin (5 �m) normal lung and lung tumor FFPE tissue sections using the miRNeasy FFPE Kit. cDNA was then prepared from each total RNA in a miScript II reverse transcription reaction using HiSpec Buffer. In real-time PCR, the Human miFinder miScript miRNA PCR Array, in combination with the miScript SYBR Green PCR Kit, was used to profile mature miRNA expression. Data analysis was performed using the online miScript miRNA PCR Array data analysis tool. The raw data in Panel A (CT Values: FFPE Isolations 1, 2, and 3) demonstrates the high reproducibility that can be achieved using the miRNeasy FFPE Kit in combination with the miScript PCR System and miScript miRNA PCR Arrays. Each isolation was from a different FFPE tissue section, with all three normal lung samples coming from one donor. When normal and tumor tissue samples are compared in Panel B, a scatter plot of 2-ΔΔCT values demonstrates that significant differences exist between the mature miRNA expression levels of the two tissue types (Panel B, � 3-fold [red lines] used as a cutoff for significance). The online miScript miRNA PCR Array data analysis tool automatically performs all ΔΔCT based fold-change calculations from your uploaded raw threshold cycle data and provides various statistical outputs such as a scatter plots, fold-regulation values, and volcano plots. Using the miRNeasy FFPE Kit, miScript PCR System, and miScript miRNA PCR Arrays, miRNA expression patterns in FFPE samples can be rapidly profiled using real-time PCR.

miScript Preamplification Unlocks miRNA Expression Profiles in Limiting Samples


Total RNA was isolated from 5 �l aliquots of normal (n=3) and colorectal cancer (n=3) serum (each isolation was from a different serum donor) using the miRNeasy Serum/Plasma Kit. cDNA was then prepared from 0.7 �l serum equivalence (SE) of each total RNA isolation in a miScript II reverse transcription reaction using HiSpec Buffer. Following reverse transcription, one-tenth of the cDNA preparation (0.07 �l SE) was used in a miScript PreAMP reaction with the Human Serum & Plasma 384HC miScript PreAMP Primer Kit. From there, the preamplified cDNA was diluted 20-fold, and 1 �l of diluted cDNA was used per well of the Human Serum & Plasma 384HC miScript miRNA PCR Array. This PCR array profiles the expression of 372 miRNAs detectable in human serum and plasma samples using the miScript PCR System. A scatter plot of 2-ΔCT values demonstrates that significant differences exist between the mature miRNA expression levels of the normal serum and colorectal cancer serum pools (Panel B, � 2-fold [red lines] used as a cutoff for significance). Those targets that exhibited differential expression include novel miRNAs as well as miRNAs whose expression has been previously shown to be regulated in colorectal cancer (hsa-miR-19b, hsa-miR-29b, hsa-miR-106b, and hsa-miR-223)(1,2).

1. Arndt, G., L. Dossey, et al. (2009). "Characterization of global microRNA expression reveals oncogenic potential of miR-145 in metastatic colorectal cancer." BMC Cancer 9(374).

2. Volinia, S., G. Calin, et al. (2006). "A microRNA expression signature of human solid tumors defines cancer gene targets." PNAS 103(7): 2257-61.

PRODUCT SUPPORT

Technical Support

Working Protocol Required Reagents and Instruments
Overview of miRNA PCR Arrays User Manual

Presentations

Attend a Live Web Seminar View a Slide Presentation

Purchase Support

miScript miRNA PCR Array miScript miRNA PCR Assay
Custom miScript miRNA PCR Arrays Have a microRNA specialist contact me

miRNA Home
miRNA PCR Array
miRNA Targets PCR Array
miRNA qPCR Assay
Find Your miRNA
qPCR Master Mixes
Service Core
miRNA PCR Service