Home > Products and Services > miRNA Home > Performance
miScript miRNA qPCR Array and Assay Performance Examples
Discrimination & Specificity, Sensitivity & Dynamic Range, Reproducibility
Real-time RT-PCR is the most sensitive and reliable method for analyzing the expression of nucleic acids like miRNA. Its wide dynamic range makes it the preferred choice for simultaneously quantifying both rare and abundant sequences in the same sample. However, the small size and high degree of similarity among miRNA sequences makes quantitative analyses of their abundance very challenging. Any assay for miRNA must not only demonstrate the sensitivity and reproducibility expected of real-time PCR, but also be specific enough to discriminate between sequences that differ by as little as one mismatch. The experimental results below will show that the miScript PCR Array System meets these performance criteria.
miScript miRNA Assay Design Improves Discrimination & Specificity
The proprietary primer design of the miScript miRNA PCR Array and Assays distinguishes miRNA family members with single nucleotide mismatches providing greater discrimination and specificity than other commercial providers.
miRNA sequence |
Let-7b |
UGAGGUAGUAGGUUGUGUGGUU |
Let-7c |
UGAGGUAGUAGGUUGUAUGGUU |
miR-98 |
UGAGGUAGUAAGUUGUAUUGUU |
Let-7d |
AGAGGUAGUAGGUUGCAUAGUU |
Let-7e |
UGAGGUAGGAGGUUGUAUAGUU |
Let-7a |
UGAGGUAGUAGGUUGUAUAGUU |
Let-7f |
UGAGGUAGUAGAUUGUAUAGUU |
Let-7g |
UGAGGUAGUAGUUUGUACAGUU |
Let-7i |
UGAGGUAGUAGUUUGUGCUGUU |
|
cDNA prepared using HiSpec Buffer: Relative detection (as % of perfect match) |
cDNA used in PCR |
miScript Primer Assay Used |
Let-7b |
Let-7c |
miR-98 |
Let-7d |
Let-7e |
Let-7a |
Let-7f |
Let-7g |
Let-7i |
Let-7b |
100.00 |
1.62 |
0.00 |
0.00 |
0.01 |
0.01 |
0.00 |
0.01 |
0.00 |
Let-7c |
2.03 |
100.00 |
0.00 |
0.00 |
5.92 |
0.38 |
0.00 |
0.00 |
0.00 |
miR-98 |
0.00 |
0.00 |
100.00 |
0.00 |
0.01 |
0.00 |
0.00 |
0.00 |
0.01 |
Let-7d |
0.00 |
0.01 |
0.00 |
100.00 |
0.00 |
2.48 |
0.00 |
0.00 |
0.00 |
Let-7e |
0.00 |
0.00 |
0.00 |
0.02 |
100.00 |
0.67 |
0.01 |
0.00 |
0.00 |
Let-7a |
0.00 |
1.46 |
0.01 |
0.76 |
6.27 |
100.00 |
0.29 |
0.04 |
0.00 |
Let-7f |
0.00 |
0.01 |
0.00 |
0.01 |
0.03 |
0.97 |
100.00 |
0.04 |
0.00 |
Let-7g |
0.00 |
0.00 |
0.00 |
0.00 |
0.00 |
0.00 |
0.00 |
100.00 |
0.00 |
Let-7i |
0.00 |
0.00 |
0.01 |
0.00 |
0.00 |
0.00 |
0.00 |
0.67 |
100.00 |
The RNA sequences of the Let-7 isoforms are shown. Base changes are bold and underlined. Synthetic miRNAs of each Let-7 isoform were used in cDNA synthesis reactions performed with the miScript II RT Kit using miScript HiSpec Buffer. An aliquot of each cDNA was used as template in real-time PCR reactions with a miScript Primer Assay for each isoform and the miScript SYBR Green PCR Kit. The % relative detection was calculated using the differences between the CT values achieved from the mismatching miScript Primer Assays and those from the perfectly matching miScript Primer Assays (% relative detection = 2-ΔCT x 100). This data demonstrates the ability of the miScript PCR System to efficiently discriminate between closely related isoform family members.
Unique Patent-Pending RT Chemistry Decreases Non-Specific Background Signals that Plague Other Commercially Available Products
The patent-pending chemistry of the miScript II RT Kit using HiSpec Buffer preferentially reverse transcribes mature miRNA, thereby decreasing non-specific background and increasing sensitivity. miScript Primer Assays can provide three orders of magnitude greater sensitivity than competing miRNA qPCR assays. Other assays can amplify non-specific products that tend to be more evident at lower amounts of input material.

Total RNA was purified from HeLa S3 cells using the miRNeasy Mini Kit. cDNA was prepared from 500 ng of total in a miScript II reverse transcription reaction using HiSpec Buffer. For Company X, cDNA was prepared from 500 ng according to the user manual. Each cDNA was then used as a template in real-time PCR reactions using either the Human miRNome miScript miRNA PCR Array (miScript) or Company X miRNome PCR Array. This data demonstrates the background-eliminating chemistry of the miScript II RT Kit using HiSpec Buffer.
The miScript PCR System Offers Exceptional Dynamic Range and Copy Number Linearity
The miScript PCR System, with cDNA prepared using HiSpec Buffer demonstrates linearity from 2 µg to as low as 10 pg input total RNA or from 10 to more than 106 copies of miRNA cDNA template. The wide dynamic range means that miRNA sequences expressed at vastly different amounts can be detected simultaneously.
A Highly linear cDNA synthesis reactions. Total RNA was purified from HeLa S3 cells using the miRNeasy Mini Kit. cDNA was prepared in a miScript II reverse transcription reaction using HiSpec Buffer for a range of RNA amounts from 10 pg to 2 µg. Each cDNA was then used as a template in real-time PCR reactions using a miScript Primer Assay for 3 mature miRNAs (miR-16, miR-20a, and miR-21) and the miScript SYBR Green PCR Kit. This data demonstrates the broad dynamic detection range that is achievable when using the miScript II PCR System. B Synthetic miR-21 was used to generate cDNA using the miScript II Reverse Transcription Kit under both the HiSpec and HiFlex buffering conditions. A range of amounts from 10 copies to 106 copies of this cDNA was used in real-time PCR using the miScript PCR System. Real-time PCR was performed on the Rotor-Gene Q real-time PCR insturment. The resultant CT values decreased linearly with increasing miRNA copy number, indicating sensitive detection from a wide range of template amounts.
miScript miRNA PCR Arrays Enable High Experimental Reproducibility

Total RNA was purified using the miRNeasy Minit Kit from A 2 identical HeLa S3 cell pellets with identical passage numbers and B 2 HeLa S3 cell pellets collected from different parental stocks at different times. Using the miScript PCR System, cDNA was prepared and used as a template in real-time PCR with the miFinder miScript miRNA PCR Array. Plotting CT values of the replicates against each other demonstrated the high technical and biological reproducibility of the results. These experiments were performed by a first-time user of the miScript PCR System.
miScript miRNA PCR Arrays Enable Low Operator to Operator Variation, even when preamplification is performed
These data demonstrate the high operator to operator reproducibility that is achievable when using the miScript PCR System. cDNA was prepared from a human universal reference RNA sample using the miScript II RT Kit with miScript HiSpec Buffer. Three different users performed preamplification using the miScript PreAMP PCR Kit and miFinder miScript PreAMP Pathway Primer Mix. Preamplified cDNA was used for miRNA profiling in duplicate with the miFinder miScript miRNA PCR Array. High levels of correlation were observed between users when CT values were A compared on a scatter plot or B plotted for all 3 users.
|